Disease Resistant Cultivars
Trending Questions
Q.
Pusa-Gaurav variety resistant to insect pest developed by hybridization and selection belong to?
Bottle gourd
Brinjal
Wheat
Rapeseed mustard
Q. Which of the following is a Brassica cultivar resistant to white rust disease?
- Himagiri
- Pusa swarnim (karan rai)
- TN-1
- Triticum
Q.
Which one of the following is an improved variety of wheat?
A.77
Sonalika
Chandramukhi
Kuber
Q.
Gundhi bug is a pest of
Rice
Mustard
Wheat
Groundnut
Q. Which of the following is a chilli cultivar resistant to leaf curl disease?
- Himagiri
- TN-1
- IR-8
- Pusa sadabahar
Q. Which of the following is a wheat cultivar having resistance to leaf and stripe rust disease?
- Pusa sadabahar
- IR-8
- Himagiri
- TN-1
Q. Match the Column I with II.
| Column I | Column II |
| A. Pusa Shubhra | I. Leaf and stripe rust |
| B. Pusa Swarnim | II. Curl blight black rot |
| C. Pusa Sadabahar | III. Chilly mosaic virus |
| D. Himgiri | IV. White rust |
- A-I, B-IV, C-II, D-III
- A-II, B-IV, C-III, D-I
- A-IV, B-III, C-II, D-I
- A-I, B-II, C-IV, D-III
Q. Which of the following is a correct match between crop, variety and resistance to diseases?
| Crop | Variety | Resistance to diseases | |
| A | Wheat | Himgiri | White rust |
| B | Brassica | Pusa Sadabahar | Black rot |
| C | Cowpea | Pusa komal | Bacterial blight |
| D | Chilli | Pusa swarnim | Chilly mosaic virus |
- C
- B
- A
- D
Q. (a) Why are the plants raised through micropropagation termed as somaclones?
(b) Mention two advantages of this technique. [2]
(b) Mention two advantages of this technique. [2]
Q. What is point mutation? Give one example.
Q. Give different types of cry genes and pests which are controlled by the proteins encoded by the genes.
Q. pBR322 was the first artificial cloning vector to be constructed. What does "BR" stands for?
- Bacteriophage and Recombinant
- Boyer and Replicative
- Boliver and Rodriguez
- None of these
Q. Name the most commonly used natural vector for cloning genes in plants.
Q. How is copy number of plasmid vector related to the yield of recombinant protein?
Q. Which of the following is a chilli cultivar resistant to leaf curl disease?
- Himagiri
- TN-1
- IR-8
- Pusa sadabahar
Q. Triticale, first man-made cereal crop, has been obtained by crossing wheat with :
- Sugarcane
- Rye
- Barley
- Pearl millet
Q. 'Himagiri' developed by hybridization and selection for disease resistance against rust pathogens is a variety of :
- Chilli
- Maize
- Wheat
- Sugarcane
Q. Which of the following is a chilli cultivar resistant to leaf curl disease?
- Himagiri
- TN-1
- IR-8
- Pusa sadabahar
Q. 'Himagiri' developed by hybridization and selection for disease resistance against rust pathogens is a variety of :
- Wheat
- Chilli
- Maize
- Sugarcane
Q. Draw a neat labelled diagram of PBR322.
Q. N.E. Borlaug was awarded Nobel prize for his work on wheat breeding. He received this prize in the branch of
- Physiology and medicine
- Botany
- Economics
- Peace
Q. Which of the following method is used in horizontal gene transfer?
- Transduction
- Transformation
- Conjugation
- All of the above
Q. 'Himgiri' developed by hybridization and selection for disease resistance against rust pathogens is a variety of
- Wheat
- Chilli
- Maize
- Sugarcane
Q. A portion of a gene was sequenced in two individuals. What type of mutation has occurred in individual two?
Individual I:
mRNA: AUGACUCACCGAGCGCGAAGCUGA
Protein: Met−Thr−His−Arg−Ala−Arg−Ser−Stop
Individual II:
mRNA: AUGACUCACUGAGCGCGAAGCUGA
Protein: Met−Thr−His−Stop
Individual I:
mRNA: AUGACUCACCGAGCGCGAAGCUGA
Protein: Met−Thr−His−Arg−Ala−Arg−Ser−Stop
Individual II:
mRNA: AUGACUCACUGAGCGCGAAGCUGA
Protein: Met−Thr−His−Stop
- Frame-shift
- Deletion
- Silent
- Non-sense
Q. Assertion :Breeding and development of cultivars resistance to diseases enhances food production. Reason: Cultivar resistance to diseases reduces the dependence on use of fungicides and bacteriocides.
- Both Assertion and Reason are correct and Reason is the correct explanation for Assertion
- Both Assertion and Reason are correct but Reason is not the correct explanation for Assertion
- Assertion is correct but Reason is incorrect
- Both Assertion and Reason are incorrect
Q. In a recombinant DNA technique the term vector refers to
- plasmids that can transfer foreign DNA into a living cell
- cosmids that can cut DNA at specific base sequence
- plasmids that can join different DNA fragments
- cosmids that can degrade harmful proteins
Q.
Which one of the following is a case of wrong matching?
Micropropagation - In vitro production of plants in large numbers
Callus - Unorganised mass of cells produced in tissue culture
Somatic hybridization - Fusion of two diverse cells
Vector DNA - site for tRNA synthesis
Q. Match Column-I with Column-II and select the correct option from given codes.
Column−IColumn−IIA.Brassica(i)HimgiriB.Okra(ii)Pusa KomalC.Wheat(iii)Pusa GauravD.Cowpea(iv)Pusa Sawani
Column−IColumn−IIA.Brassica(i)HimgiriB.Okra(ii)Pusa KomalC.Wheat(iii)Pusa GauravD.Cowpea(iv)Pusa Sawani
- A-(iii), B-(iv), C-(i), D-(ii)
- A-(i), B-(iii), C-(ii), D-(iv)
- A-(iv), B-(iii), C-(i), D-(ii)
- A-(ii), B-(iv), C-(i), D-(iii)
Q. RR-21 is high yielding variety of
- Rice
- Wheat
- Gram
- Sugarcane
Q. Identify the wrong statements.
A) Genetic modification in plants helped to reduce post-harvest losses.
B) In tobacco plants 'Cry' genes are introduced against nematodes.
C) Gene therapy is to be taken for infectious diseases, where genes are inserted into person's cells and tissues to treat diseases.
D) Injustice, inadequate compensation and benefit sharing are related to molecular diagnosis.
A) Genetic modification in plants helped to reduce post-harvest losses.
B) In tobacco plants 'Cry' genes are introduced against nematodes.
C) Gene therapy is to be taken for infectious diseases, where genes are inserted into person's cells and tissues to treat diseases.
D) Injustice, inadequate compensation and benefit sharing are related to molecular diagnosis.
- B, C, D
- A, B, C
- A, B, D
- A, C, D
