Process of Transcription
Trending Questions
Q.
If the sequence of the coding strand in a transcription unit is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of mRNA.
Q.
Which of the following steps in transcription is catalysed by RNA polymerase?
All of the above
Termination
Elongation
Initiation
Q.
Is lac operon present in eukaryotes?
Q. Which of the following statements about lac operon in E. coli is true?
- Promoter is the binding site for the lac repressor
- Operon is only switched on in the absence of lactose in the growth medium
- β-galactosidase is only produced in large quantities when the lac repressor is bound to the operator
- Lac operon mRNA is a polycistronic mRNA
Q. What is Dicer? What is its action? What is RISC (RNA induced silencing complex)?
Q. During transcription, RNA polymerase holoenzyme binds to a gene promoter and assumes a saddle-like structure. What is its DNA-binding sequence?
- TATA
- TTAA
- AATT
- CACC
Q. Which of the following is true of RNA synthesis (transcription)?
- RNA synthesis is always in the 5' - 3' direction
- RNA polymerase needs a primer to initiate transcription
- In transcription, U is inserted opposite T
- New nucleotides are added on to the 2' OH of the ribose sugar
Q. Which enzyme has polymerizing activity in 5-3 direction but exonuclease activity in 3-5 direction and how
Q. If the sequence of bases in the coding strand of the transcription unit is 5'-ATTGATCGC-3', then find out the correct sequence of the mRNA transcribed from this transcription unit
- 3'-AUUGAUCGC-5'
- 5'-UAACTAGCC-3'
- 3'-AUUCATCGG-5'
- 5'-AUUGAUCGC-3'
Q.
Which principle governs the process of transcription?
Q. Choose the wrong statement in the process of protein synthesis.
- Translation is the process, in which proteins are synthesised from the RNA
- In the presence of DNA polymerase enzyme, the mRNA is formed based on the triplet codes
- After uncoiling of DNA molecule, one strand acts as a template for the formation of mRNA
- The mRNA that leaves nucleus reached cytoplasm and gets attached with 30S ribosomal subunit
- The amino acids are transferred from the intracellular amino acid pool to the active ribosomes by the tRNA
Q. Regulatory proteins are the accessory proteins that interact with RNA polymerase and affect its role in transcription. Which of the following statements is correct about regulatory protein?
- They only increase expression.
- They only decrease expression.
- They interact with RNA polymerase but do not affect the expression.
- They can act both as activators and as repressors.
Q. The function of tRNA is to
- Synthesize amino acids
- Transcribe the genetic code
- Form a site for protein synthesis
- Transport specific amino acids to specific sites on the mRNA
Q. Describe post transcriptional processing of RNA in eukaryotes.
Q. The sequence of coding strand of DNA in a transcription unit is 5′−GGAATTCCG−3′. What is the sequence of nucleotides of the following?
a) Its complementary strand
b) The mRNA.
a) Its complementary strand
b) The mRNA.
Q. Given below is a single stranded DNA molecules Frame and label its sense and antisense RNA molecule.
5′ATGGGGCTC3′ sense
5′ATGGGGCTC3′ sense
Q.
The strand of DNA acting as template for mRNA transcription is
(a) Coding strand (b) Noncoding strand (c) Sense strand (d) Antisense strand. The correct answer is
- a and c
- a and d
- b and c
- b and d
Q.
If the sequence of coding strand in transcription is as follows:
5’- ATGCATGCATGCATGCATGCATGCATGC - 3’
Write down the sequence of mRNA. [2]
Q.
What is a response element?
Q.
The correctly matched pair is
RNA polymerase - RNA primer
Central dogma - codon
Okazaki fragments - splicing
Restriction endonuclease - genetic engineering
Q. The term refers to the sequence of DNA that is copied during the synthesis of mRNA.
- leading strand
- template strand
- coding strand
- lagging strand
Q. The sequence of the mRNA transcribed by the given segment of DNA will be -
5′¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ATGTCCTTGCAACAT3′ - sense strand
3′¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯TACAGGAACGTTGTA5′
- 5' AUGUCCUUGCAACAU 3'
- 5' UACAACGUUCCUGAU 3'
- 5' UACAGGAACGUuGTA 3'
- 5' AUGUUGCAAGGACAU 3'
Q. Which of these is a characteristic of Repetitive DNA?
- Rapid rate of renaturation
- Low degree of polymorphism
- An integral part of proteins
- Represents broad peak in buoyant density centrifugation
Q. Catalytic property of RNA is shown by all of the following except
- Telomerase
- Heterogenous nuclear RNA
- Ribonuclease - P
- 23SRNA
Q.
describe the process of transcription
Q. Give a brief account of the different steps involved in the translation of mRNA into a polypeptide in prokaryotes.
Q. mRNA is synthesised on DNA template in which direction:
- 5′→3′
- 3′→5′
- Both
- Any
Q. If the sequence of bases in sense strand of DNA is 5′−GTTCATCG−3′, then the sequence of bases in its RNA transcript would be
- 5′−GTTCATCG−3′
- 5′−GUUCAUCG−3′
- 5′−CAAGTAGC−3′
- 5′−CAAGUAGC−3′
Q. Why is tRNA called an 'adapter' ?
Q. What are the functions of (i) methylated guanine cap ? (ii) Poly - A tail on a mature RNA ?